Introduction
Geminiviruses have small, circular, single-stranded (ss)
DNA genome encapsulated in twin icosahedral particles (Inoue-Nagata et al. 2016;
Loriato et al. 2020). Over the
past twenty years the disease incidence and severity caused by these little
pathogens have enormously increased posing a potential threat to agriculture (Khalid et al.
2017; Ouattara et al. 2020; Zaidi et al. 2020; Zhang et al. 2020). The estimated yield losses of the infected
plants are enormous (Osei et al. 2017; Tsai and Huang 2017). Pepper fields in
Indonesia were affected by whitefly transmitted Geminiviruses,
resulting in 20–80% yield losses (Hidayat et al. 2011; Kenyon et al. 2014). In Africa, cassava crops were heavily
affected by Cassava mosaic virus (CMV) in 12 countries since the 1980s (Legg et al.
2011; Bruyn et al. 2016; Osei et al. 2017). Similarly, Tomato
leaf curl disease (TLCD), caused by Tomato leaf curl virus (ToLCV), is
the most prevailing disease of tomato and capable of 100% field destruction in
many tropical and subtropical countries (Segbefia et al. 2018; Desbiez et al. 2019; Ouattara et al. 2020). The emergence of
new recombinants associated with tomato has been recently found in Oman during
field surveys (Al-Shihi et al. 2014; Al-Shihi et al.
2018a). More than one virus was found to be associated with tomato
crops, resulting in 100% yield losses (Al-Shihi et al. 2016; Ammara et al. 2017).
Traditionally, whitefly transmitted begomoviruses are
controlled by the excessive use of insecticides/pesticides that cause more
damage to the ecosystem (Tsai and Huang 2017).
The durable resistance in plants against these ever evolving geminiviruses is
difficult to achieve by traditional plant breeding approaches. Thus,
engineering resistance using molecular tools seems a more convenient option
against these groups of viruses.
Geminiviruses have small genome contain either one or
two genomic units (DNA A and B) and heavily rely on a host for replication of
both viral and plant chromosomal DNA (More et al. 2019; Ouattara et al. 2020). CP gene is not
only involved in viral genome packaging, but also found associated with a few
other functions. The major functions include vector specificity (Khalid et al.
2017), protection of viral DNA in the vector (Azzam et al. 1994),
virus spread (Felker et al. 2019) and transfer of viral DNA in/out of nucleus (Liu et al.
1999).
The central part of coat protein sequence is very crucial
for transmission (Höhnle et al. 2001; Malik et al.
2005), while half coat protein from N-terminal is the DNA binding domain
(Unseld et
al. 2004; Malik et al. 2005).
The central part as well as C and N-terminal and sequences appear to be
involved in CP multimerization (Liu et al. 2001; Unseld et al. 2001), which is essential for virus capsid
assemblage and insect transmission (Zhang et al. 2001b; Hipp et al. 2016).
Coat protein (CP)-based resistance is widely used to
confer resistance in plants against geminiviruses. Numerous crops have been reported and released for commercial cultivation by using viral CP (Dasgupta et al. 2003). However, it is important to
note that in most of these examples the resistance was reported to be RNA
based, rather than protein mediated. It was demonstrated that CP based
resistance is somewhat specific as there is relationship between resistance
sequence similarity between the CP of transgenic plants and the CP of
challenging virus (Saxena et al. 2011).
Begomoviruses are often found associated with
betasatellites, which are circular ssDNA satellite molecules, having half the size of their helper begomovirus (Xu et al. 2019).
Betasatellites are dependent on their helper begomovirus for vector
transmission, encapsidation and systemic movement in plants (Malathi et al.
2017). The major functions of betasatellites
are symptom induction, host range determination and interaction with various
host factors (Malathi et al. 2017).
In this
study CPsyn was used to develop resistance against TYLCV-OM. The
role of CPsyn was investigated in transgenic tomato plants against
TYLCV-OM and TYLCV-OMB isolated from tomato fields in Oman.
Materials and Methods
Construction of CPsyn
A highly
conserved 777 bp region of CP (V1 of TYLCV-OM) ORF, representing the whole
coding sequence, was selected to design synthetic CP
sequence. Codon optimization was acrried out
by codon usage table for Solanum lycopersicum [gbpln]: 1452 CDS's (634390
codons) from NCBI-GenBank to increase the
overall transaltional efficiency of codons without changing the amino acids
sequence (Fig. 1–2). The synthetic CP gene was
commercially synthesized by GenScript (GenScript Inc., New Jersey, USA) and was provided in pUC57 cloning vector.
Synthesized CP gene was cloned in pGreen 0029 plant expression vector under
pFMV promoter and G7 terminator at HindIII/ XbaI site to avoid promoter
silencing. The synthetic CP possesses no sequence identity to the TYLCV-OM-CP;
the low identity was done to avoid gene silencing.
Tomato transformation
The CPsyn construct was mobilized in Agrobacterium tumefaciens strain AGL1 by electroporation.
Tomato var. Pusa Ruby was transformed with CPsyn by Agrobacterium-mediated tomato tissue
culture according to a protocol described by Ammara et al. (2014). CPsyn gene-based
primer pair was used to screen stably transformed T0 tomato plants.
PCR-positive plants were further analyzed for the presence of transgene by
Southern blotting. All transgenic lines showed normal phenotype and produced
viable seeds by self-pollination. T1 transgenic lines were
challenged with TYLCV-OM for resistance evaluation.
Inoculation of transgenic lines with TYLCV-OM
Fig. 1: The genome organization of TYLCV -OM. The CP gene of TYLCV-OM was used
to prepare synthetic CPsyn to offer
protein mediated resistance. The overall arrangement of CPsyn
under its independent promoter and terminator is shown below the circular
organization of TYLCV-OM.
Fig. 2: A synthetic CP (CPsyn)
sequence designed and synthesized by codon optimization of wild type viral
sequence
Positive putative T0 plants were selected for
further screening and resistance evaluation, from which seeds were collected by
self-pollination. Seeds from seven selected lines were germinated on kanamycin
media to get T1 generation. Germinated seedlings on selection media
were transferred to pots for T1 resistance evaluation. Transgene was
confirmed in these seedlings by PCR. Each independent line with ten replicates
was germinated and maintained in a glass house under 28–29°C temperature with
80–90% relative humidity. These lines were infiltrated with Agro-infectious
construct of TYLCV-OM (Acc. No. DQ644565.1) and
TYLCV-OM/TYLCV-OMB (Acc. No. HE800544.1) as described by Llave et al.
(2000).
Ten non-transgenic
tomato plants of the same age were infiltrated with Agro-infectious construct
of TYLCV-OM and TYLCV-OM/TYLCV-OMB as positive control. All agro-inoculated
plants were kept in a glasshouse and were monitored for symptoms development
and severity until harvesting stage. Leaf samples were collected at 30 days
post inoculation (dpi) when all control plants developed full symptoms.
Southern hybridization
For the confirmation of transgene, 777bp fragment of CP
gene was digested by BamHI and SalI, followed by gel purification and then
labelling with digoxigenin using a DIG-High Prime DNA Labeling and Detection
Starter Kit I (Roche GmbH, Germany). For the detection of virus in transgenic
lines, 650-bp fragment of CP gene of TYLCV-OM was used. Amplification was done
using FDCP/RDCP primers, followed by labelling with digoxigenin. To detect
betasatellite, 1084-bp fragment restricted byBamHI and XbaI of a betasatellite
clone (Tb-1) was gel purified and labeled with digoxigenin.
Quantification of viral molecules in resistant transgenic
plants by qPCR
Screening of transgenic lines harboring CPsyn was
carried out by conventional PCR and southern hybridization. Three resistant
lines, which were negative by southern hybridization, were further analyzed by
qPCR to quantify the virus titer in these lines. SYBER green dye (IQ SYBER
Green supermix by BIO-RAD U.S.A.) was used for this experiment. Primer pair
were designed on CP gene of TYLCV-OM QF (5’TAAAAGGCGCACTAATGGGTAGACCGTAGA3’)
and QR (5’GGCGATAACCACCTTCCCG3’) to amplify 150 bp product specific to
TYLCV-OM.
Serial dilution of a plasmid which contains the TYLCV-OM
genome was used to obtain standard. Thus, series of dilutions were prepared and
5 of them were used in order to get a standard curve. There were 10-fold
decreases in each dilution (10 ng, 1 ng, 0.1 ng, 0.01 ng and 0.001 ng). ABI iCycler
software (version 3.1) was used to handle data acquisition and analysis which
automatically calculates the threshold cycle Ct values and the
parameters of the standard curves.
The reaction mixture (25 μL) contained 0.4 μL
of each primer (QF and QR; 4 picomole), 1X iQ SYBR
Green Supermix and 2 μL DNA sample (5 ng/μL for all
known samples). Each DNA sample was carefully measured by nanodrop before
setting up reactions. In order for the standard curves to fall within the
range, DNA concentration was then adjusted up to 10 ng/μL
for each sample. PCR was performed in the Real-Time PCR Detection System
(ABI) according to Azhar et al. (2010).
Results
Construction of CPsyn
In this study the ability of CPsyn to develop
resistance against a heterologous monopartite TYLCV-OM has been investigated.
Synthesized CP gene was cloned in pUC57 vector containing pFMV promoter and G7
terminator at HindIII/ XbaI site. The whole cassette of 1596 bp (CP gene with promoter
and terminator) was lifted by I-CeuI homing enzyme and cloned in modified
pGreen plant expression vector at I-CeuI site.
Table 1: Infectivity of
TYLCV-OM/TYLCVOMB in transgenic tomato plants harbouring
CPsyn
Treatments |
Exp |
CPsyn transgenic lines |
Non
transgenic control |
||||||||
41 |
43 |
44 |
55 |
66 |
67 |
101 |
N.
C* |
P. C** |
P.C*** |
||
TYLCV-OM |
I |
1/10 |
2/10 |
6/10 |
5/10 |
0/10 |
1/10 |
1/10 |
0/10 |
10/10 |
10/10 |
II |
0/10 |
1/10 |
5/10 |
6/10 |
1/10 |
0/10 |
1/10 |
0/10 |
10/10 |
10/10 |
|
TYLCV-OM+ TYLCVOMB |
I |
3/10 |
4/10 |
8/10 |
5/10 |
2/10 |
3/10 |
3/10 |
0/10 |
10/10 |
10/10 |
II |
2/10 |
3/10 |
9/10 |
8/10 |
3/10 |
2/10 |
4/10 |
0/10 |
10/10 |
10/10 |
|
Southern$ for TYLCV-OM |
|
- |
+ |
+++ |
+++ |
- |
- |
+++ |
- |
+++ |
+++ |
Southern$ for TYLCVOMB |
|
- |
- |
+++ |
+++ |
+ |
- |
- |
- |
+++ |
+++ |
* Non-transgenic Pusa ruby
plants as healthy control.
** Pusa ruby plants inoculated
with Agrobacterium
culturesharbouringpGreen0029
# TYLCV-OM was detected in DNA extracted from plants by
PCR using
FD-CP/RD-CP primers (Table 1)
$ Southern hybridization results are given as strong
hybridization (+++),
weak hybridization (+), and no hybridization detected (−)
Fig. 3: Southern blot
analysis for the confirmation of transgene in CPsyn
transgenic lines. Genomic DNA ~10 µg digested with EcoRI for PCR positive lines probe with ~777 bp fragment of CPsyn
clone. A DNA size marker was electrophoresed in lane 1 and superimposed on
membrane. All seven transgenic lines showed single integration in genome by
giving ~777 bp single band
Tomato transformation with CPsyn construct
All lines showed a single band representing a single
integration site for each line (Fig. 3). All positive transgenic lines were
then self-pollinated and grown on kanamycin selection medium to get T1
generation. Each line with ten replicates was generated to test transgene
efficiency against TYLCV-OM.
Resistance evaluation of transgenic CPsyn
tomato lines
The typical symptoms of TYLCV infection (downward/upward curling and
yellowing) started to appear on non-transgenic Pusa Ruby plants after 28 days
post inoculation (dpi) with TYLCV-OM and TYLCV-OM/TYLCV-OMB. The non-transgenic
Pusa Ruby plants developed severe symptoms (yellowing, curling, crumpling) of
TYLCV-OM disease in newly developed leaves by 28 dpi (Fig. 4). Transgenic lines
expressing CPsyn inoculated with TYLCV-OM were resistant at 28 dpi
except line # 41, 66 & 67 (Table 1). A small number of replicates started
developing milder symptoms at 60 dpi in all transgenic lines showing resistance
response. All lines were resistant at 60 dpi when inoculated with TYLCV-OM but
started developing milder symptoms when co-inoculated with TYLCV-OM/TYLCVOMB.
PCR analysis showed the presence of TYLCV-OM and TYLCVOMB in most replicates.
All PCR positive replicates were then analyzed by Southern hybridization. Breakdown
of resistance was observed in Line #44 and 55. In line # 43, 44, 55 and 101 high
titers of TYLCV-OM and TYLCV-OMB were observed by Southern blot hybridization (results not shown). However, in transgenic line
# 41, 66 and 67 level of both TYLCV-OM and TYLCV-OMB was negligible in
comparison to control and unable to detect by southern hybridization.
Fig. 5: Quantitative
RT-PCR to quantitate viral DNA particles in transgenic and non-transgenic
tomato plants inoculated with TYLCV-OM and TYLCV-OMB. Blue bar represents viral
DNA concentration in inoculated plants. T1 and T2 are control non-transgenic
plants inoculated with TYLCV-OM and T3 is infected non-transgenic plant
inoculated with TYLCV-OM/TYLCV-OMB while NTC is non-transgenic healthy control
plant. Transgenic lines 41, 66 and 67 were analyzed for the quantification of
virus as these lines were negative by Southern hybridization. Each bar is the
mean of three replicates and the error bars indicate standard deviation
Quantitative
PCR to determine virus titer in inoculated plants
Fig. 4 A. Pusa ruby control plants showing TYLCV-OM B. Pusa ruby control plants showing TYLCV-OM Panel C, E,
G and I are Line 41, 43 66 and 67 inoculated with TYLCV-OM. While
panel D, F, H and J are line 41, 43, 66 and 67 inoculated
with TYLCV-OM/TYLCV-OMB. Photographs were taken at 60 dpi
The results of Q-PCR are summarized in Fig. 5. Although the virus was
detected in all three lines but the level of virus was
significantly lower than the control plants T1–T3 in Fig. 5. It
is clear from qPCR results that in the presence of betasatellite, the number of
virus particles has increased even in all the inoculated resistant transgenic lines. There is
almost 150-fold less virus present among transgenic
lines but there is only 10-fold difference between plants inoculated with
TYLCV-OM and with TYLCV-OMB. The non-transgenic negative control was also used
to see the overall efficiency of reaction and no detectable virus particles
were found in these controls. The overall reaction efficiency of qPCR was
98.4%. The Ct values with non-transgenic negative control and without template
DNA were equal to the number of cycles used in the qPCR reaction. In contrast,
TYLCV-infected control (non-transgenic) Pusa Ruby plants showed amplification
in very low Ct values and contain relatively large amounts of viral DNA (Fig.
5). The melt curve analysis resulted in single peak and represents that single
product was amplified and all PCR products melted at single temperature.
Discussion
The first successful demonstration of CP based
resistance was achieved in Nicotiana tabacum against Tobacco mosaic
virus (TMV) (Abel et al. 1986). The model to explain resistance is that
transgenically expressed CP assembles to form virus-like particles (VLPs) to
block the uncoating of virus. Alternatively, CP inhibits virus disassembly by
shifting the disassembly-assembly reaction in favor of assembly, thereby
preventing virus infection in the inoculated cells (Register III and Beachy 1988). Later on, it was suggested that the
CP inhibits disassembly of challenged viruses in the initial infected cells (Bendahmane et
al. 1997).
In the present study, CPsyn was used to
develop resistance against TYLCV-OM and TYLCV-OM/ToLCB-OM isolated from tomato
fields in Oman. The results of the study showed that the transient expression
of CPsyn with begomovirus-betasatellite complex showed 100%
resistance phenotype while in transgenic plants challenged with TYLCV-OM and
TYLCV-OM/ToLCB-OM symptom development and infectivity was slightly impaired.
However, three transgenic lines remained symptomless at 90 dpi; qPCR detected
low virus level in these specific lines. The possible reason for this
differential behavior is the transgene copy number and expression. Further
detailed studies are required to fully characterize this differential behavior
of CPsyn transgenic tomato plants especially with relation to gene
copy number and level of resistance.
TYLCV-OM is a monopartite begomovirus and for such viruses the CP is
essential for infectivity (Shakir et al. 2018). CP is not
essential for bipartite begomoviruses infectivity, although viruses lacking the
CP have longer latent periods among inoculation and symptoms development,
consistent with the CP having an important, if not essential, role in virus
movement (Zhang et al. 2001a, b). For this reason, it is presumed that a
CP-mediated resistance strategy against bipartite begomoviruses would not be
successful. Consistent with this statement N.
benthamiana plants expressing the ACMV CP did not show resistance (Frischmuth and Stanley 1998). Here in this
study CP was used to develop resistance against monopartite virus i.e.,
TYLC-OM and consistent with earlier studies resistance was achieved. Sinisterra et
al. (1999) were unable to show expression of the CP. Resistance in
this case correlated with CP gene transcript, suggestive of RNA mediated effect
(RNA silencing) rather than a protein-mediated effect. However, in the present
study a synthetic gene was used that has less identity to wild type CP and thus
leads to trans-dominant negative interference rather than gene silencing
(Lin et
al. 2012; Fondong 2017). Thus, the reduced amount of CP and CPsyn
would be competing for the uncoating of viral genome to initiate viral
replication. The combined action of both CP possibly reduced the replication
rate by coating the viral genome.
One
possibility that has not yet been investigated is that transgenic expression of
the CP could interfere with insect transmission. For geminiviruses the CP determines
vector specificity and is presumed to interact with specific receptors in the
digestive tract of vector (insects) to mediate acquisition of virions (Sattar et al.
2013). Thus, transgenic expression of CP could potentially be used to
competitively block virus receptors in insects, thereby reducing the rate of
transmission. Consistent with this hypothesis it has been shown that purified
MSV virions treated with formaldehyde (making them non-infectious to plants)
significantly reduced transmission by the vector Cicadulina mbila when mixed with infectious virions and fed to the
insects through a membrane (Briddon et al. 1990). Presumably the
non-infectious virions competed with the infectious virions for receptors which
mediated acquisition, resulting in viruliferous vectors harboring a reduced
virus inoculum for onward transmission. It would be interesting to study the
virus acquisition by whiteflies in CPsyn transgenic plants in future
to understand the mode of action of this construct.
Conclusion
Our findings show that the expression of CPsyn
in tomatoes resulted in the induction of resistance to TYLCV-OM. Further
studies are warranted to understand the precise mechanism of resistance in
transgenic tomato plants developed during this study. The expression of
transgene with correlation to gene copy number and virus resistance level
should be studied. Additionally, all transgenic plants should be assessed for
their ability to provide protection against heterologous viruses reported from
Oman including; ToLCOMV, ToLCSDV-OM, ToLCABV, ToLCBrV, OKLCuV, WmcSV, ChLCV-OM
(Khan et
al. 2013, 2014; Ammara et al.
2015, 2017; Al-Shihi et al. 2018b).
Acknowledgments
This study was funded by Sultan Qaboos
University and The Research Council (Oman). Thanks to Dr Jamal Khan for support
during initial work.
Author
Contributions
Um E Ammara:
planned work; conducted experiments, analyzed data and wrote the manuscript;
Shahid Mansoor: planned work; proof read the manuscript; Muhammad Saeed:
planned work; proof read the manuscript; Abdullah M. Al-Sadi: planned work;
supervised work, proof read the manuscript.
References
Abel PP, RS Nelson, B De, N Hoffmann, SG Rogers,
RT Fraley, RN Beachy (1986). Delay of disease development in transgenic plants
that express the tobacco mosaic virus coat protein gene. Science 232:738‒743
Al-Shihi AA, P Hanson, AM Al-Sadi, RA Al-Yahyai,
RW Briddon, M Deadman, MS Shahid (2018a). Evaluation of tomato inbred lines for
resistance to the tomato yellow leaf curl disease complex in Oman. Crop Prot 110:91‒98
Al Shihi AA, AM Al Sadi, M Deadman, RW Briddon, MS
Shahid (2018b). Identification of a distinct strain of Cotton leaf curl Gezira
virus infecting tomato in Oman. J
Phytopathol 166:199‒205
Al-Shihi AA, AM Al-Sadi, FA Al-Said, UE Ammara, ML
Deadman (2016). Optimising the duration of floating row cover period to
minimise the incidence of tomato yellow leaf curl disease and maximise yield of
tomato. Ann Appl Biol
168:328‒336
Al-Shihi AAM, AJ Khan, S Akhtar, ATM Lima, FM
Zerbini, RW Briddon (2014). Occurrence of a new recombinant begomovirus species
infecting tomato in the Al-Batinah region of Oman. Plant Pathol 63:1177‒1184
Ammara UE, AM Al-Sadi, A Al-Shihi, I Amin (2017).
Real-time qPCR assay for the TYLCV titer in relation to symptoms-based disease
severity scales. Intl J Agric Biol
19:145‒151
Ammara UE, S Mansoor, M Saeed, I Amin, RW Briddon,
AM Al-Sadi (2015). RNA interference-based resistance in transgenic tomato
plants against Tomato yellow leaf curl
virus-Oman (TYLCV-OM) and its associated betasatellite. Virol J 12:38–49
Ammara UE, AY Al-Maskari, AJ Khan, AM Al-Sadi
(2014). Enhanced somatic embryogenesis and Agrobacterium-mediated
transformation of three cultivars of tomato by exogeneous application of
putrescine. Intl J Agric Biol
16:81‒88
Azhar MT, I Amin, ZI Anjum, M Arshad, RW Briddon,
S Mansoor (2010). Both malvaceous and non-malvaceous betasatellites are
associated with two wild cotton species grown under field conditions in
Pakistan. Virus Genes 41:417‒424
Azzam O, J Frazer, Ddl Rosa, JS Beaver, P
Ahlquist, DP Maxwell (1994). Whitefly transmission and efficient ssDNA
accumulation of bean golden mosaic geminivirus require functional coat protein.
Virology 204:289‒296
Bendahmane M, JH Fitchen, G Zhang, RN Beachy
(1997). Studies of coat protein-mediated resistance to tobacco mosaic
tobamovirus: Correlation between assembly of mutant coat proteins and
resistance. J Virol 71:7942‒7950
Briddon RW, MS Pinner, J Stanley, PG Markham
(1990). Geminivirus coat protein replacement alters insect specificity. Virology 177:85‒94
Bruyn AD, M Harimalala, I Zinga, BM Mabvakure, M
Hoareau, V Ravigné, M Walters, B Reynaud, A Varsani, GW Harkins, DP Martin, JM
Lett, P Lefeuvre (2016). Divergent evolutionary and epidemiological dynamics of
cassava mosaic geminiviruses in Madagascar. BMC
Evol Biol 16; Article 182
Dasgupta I, VG Malathi, SK Mukherjee (2003).
Genetic engineering for virus resistanc. Curr
Sci 84:341‒354
Desbiez C, E Verdin, B Moury, H Lecoq, P Millot, C
Wipf-Scheibel, S Mirzayeva, N Sultanova, G Balakishiyeva, A Mammadov, A
Kheyr-Pour, I Huseynova (2019). Prevalence and molecular diversity of the main
viruses infecting cucurbit and solanaceous crops in Azerbaijan. Eur J Plant Pathol 153:359‒369
Doyle J, JL Doyle (1990). Isolation of plant DNA
from fresh tissue. Focus 12:13‒15
Felker P, R Bunch, G Russo, K Preston, JA Tine, B
Suter, M Xiaohan, JC Cushman, WC Yim (2019). Biology and chemistry of an
umbravirus like 2989 bp single stranded RNA as a possible causal agent for
Opuntia stunting disease (engrosamiento de cladodios) - A review. J Prof Assoc Cact Dev 21:1‒31
Fondong VN (2017). The search for resistance to
cassava mosaic geminiviruses: How much we have accomplished, and what lies
ahead. Front Plant Sci 8; Article 408
Frischmuth T, J Stanley (1998). Recombination
between viral DNA and the transgenic coat protein gene of African cassava
mosaic geminivirus. J Gen Virol
79:1265‒1271
Hidayat SH, S Sulandari, N Aidawati (2011). The
emergence of yellow leaf curl disease in chilli pepper in Indonesia. In:
Emerging Geminiviral Diseases and their Management, pp:147‒165.
Sharma P, RK Gaur, M Ikegami (Eds.). Nova Science Publishers, New York, USA
Hipp K, B Schäfer, G Kepp, H Jeske (2016).
Properties of African cassava mosaic virus capsid protein expressed in fission
yeast. Viruses 8:190–203
Höhnle M, P Höfer, ID Bedford, RW Briddon, PG
Markham, T Frischmuth (2001). Exchange of three amino acids in the coat protein
results in efficient whitefly transmission of a nontransmissible Abutilon
mosaic virus isolate. Virology 290:164‒171
Inoue-Nagata AK, MF Lima, RL Gilbertson (2016). A
review of geminivirus (begomovirus) diseases in vegetables and other crops in
Brazil: Current status and approaches for management. Hortic Bras 34:8‒18
Kenyon L, WS Tsai, SL Shih, LM Lee (2014). Emergence
and diversity of begomoviruses infecting solanaceous crops in East and
Southeast Asia. Virus Res 186:104‒113
Khalid S, M Zia-ur-Rehman, U Hameed, F Saeed, F
Khan, MS Haider (2017). Transmission specificity and coinfection of mastrevirus
with begomovirus. Intl J Agric Biol
19:105‒113
Khan AJ, S Akhtar, AK Singh, AA Al-Shehi, AM
Al-Matrushi, UE Ammara, RW Briddon (2014). Recent evolution of a novel
begomovirus causing tomato leaf curl disease in the Al-Batinah region of Oman. Arch Virol 159:445‒455
Khan AJ, S Akhtar, AK Singh, RW Briddon (2013). A
distinct strain of Tomato leaf curl Sudan virus causes tomato leaf curl disease
in Oman. Plant Dis 97:1396‒1402
Legg JP, SC Jeremiah, HM Obiero, MN Maruthi, I
Ndyetabula, G Okao-Okuja, H Bouwmeester, S Bigirimana, W Tata-Hangy, G Gashaka,
G Mkamilo, T Alicai, PL Kumar (2011). Comparing the regional epidemiology of
the cassava mosaic and cassava brown streak virus pandemics in Africa. Virus Res 159:161‒170
Lin CY, WS Tsai, HM Ku, FJ Jan (2012). Evaluation
of DNA fragments covering the entire genome of a monopartite begomovirus for
induction of viral resistance in transgenic plants via gene silencing. Transg Res 21:231‒241
Liu H, Andrew, P Lucy, JW Davies, MI Boulton
(2001). A single amino acid change in the coat protein of Maize streak virus
abolishes systemic infection, but not interaction with viral DNA or movement
protein. Mol Plant Pathol
2:223‒228
Liu H, MI Boulton, CL Thomas, DAM Prior, KJ Oparka,
JW Davies (1999). Maize streak virus coat protein Is karyophyllic and
facilitates nuclear transport of viral DNA. Mol
Plant Microb Interac 12:894‒900
Llave C, KD Kasschau, JC Carrington (2000).
Virus-encoded suppressor of posttranscriptional gene silencing targets a
maintenance step in the silencing pathway. Proc
Natl Acad Sci USA 97:13401‒13406
Loriato VAP, LGC Martins, NC Euclydes, PAB Reis,
CEM Duarte, EPB Fontes (2020). Engineering resistance against geminiviruses: A
review of suppressed natural defenses and the use of RNAi and the CRISPR/Cas
system. Plant Sci 292:1–10
Malathi VG, P Renukadevi, S Chakraborty, KK
Biswas, A Roy, PN Sivalingam, V Venkataravanappa, B Mandal (2017).
Begomoviruses and their satellites occurring in India: Distribution, diversity
and pathogenesis. In: A Century of Plant Virology in India, pp:75‒177.
Mandal B, G Rao, V Baranwal, R Jain (Eds). Springer, Singapore
Malik PS, V Kumar, B Bagewadi, SK Mukherjee
(2005). Interaction between coat protein and replication initiation protein of
Mung bean yellow mosaic India virus might lead to control of viral DNA
replication. Virology 337:273‒283
More P, P Agarwal, PK Agarwal (2019).
Geminiviruses: Molecular biodiversity and global distribution in Jatropha. Physiol Mol Plant Pathol 108; Article 101439
Osei MK, E Cornelius, E Asare-Bediako, A Oppong, MD Quain
(2017). Status of begomoviruses in Ghana: The case of vegetables and root and tuber crops. In: Begomoviruses: Occurrence and Management in Asia and Africa, pp:297‒314. Saxena S, AK Tiwari (Eds.). Springer, Singapore
Ouattara A, F Tiendrébéogo, P Lefeuvre, M Hoareau,
S Claverie, A Allibert, F Chiroleu, EV Traoré, N Barro, O Traoré, JM Lett
(2020). Diversity, distribution and prevalence of vegetable-infecting
geminiviruses in Burkina Faso. Plant
Pathol 69:379‒392
Register III JC, RN Beachy (1988). Resistance to
TMV in transgenic plants results from interference with an early event in
infection. Virology 166:524‒532
Sattar MN, A Kvarnheden, M Saeed, RW Briddon
(2013). Cotton leaf curl disease - An emerging threat to cotton production
worldwide. J Gen Virol 94:695‒710
Saxena S, N Singh, SA Ranade, SG Babu (2011).
Strategy for a generic resistance to geminiviruses infecting tomato and papaya
through in silico siRNA search. Virus
Genes 43:409‒434
Segbefia MM, HM Amoatey, JK Ahiakpa, EK Quartey,
AS Appiah, J Nunoo, R Kusi-Adjei (2018). Field evaluation of tomato
varieties/breeding lines against tomato yellow leaf curl virus disease (TYLCV).
Pertan J Trop Agric Sci 41:423‒439
Shakir S, MS Nawaz-Ul-Rehman, M Mubin, Z Ali
(2018). Characterization, phylogeny and recombination analysis of Pedilanthus
leaf curl virus-Petunia isolate and its associated betasatellite. Virol J 15:134-144
Sinisterra XH, JE Polston, AM Abouzid, E Hiebert
(1999). Tobacco plants transformed with a modified coat protein of Tomato
mottle begomovirus show resistance to virus infection. Phytopathology 89:701‒706
Tsai WS, CJ Huang (2017). Begomovirus in Taiwan. In:
Begomoviruses: Occurrence and Management in Asia and Africa, pp:187‒205.
Saxena S, AK Tiwari (Eds.). Springer, Singapore
Unseld S, T Frischmuth, H Jeske (2004). Short
deletions in nuclear targeting sequences of African cassava mosaic virus coat
protein prevent geminivirus twinned particle formation. Virology 318:90‒101
Unseld S, M Höhnle, M Ringel, T Frischmuth (2001).
Subcellular targeting of the coat protein of African cassava mosaic
geminivirus. Virology
286:373‒383
Xu X, Y Qian, Y Wang, Z Li, X Zhou (2019). Iterons
homologous to helper geminiviruses are essential for efficient replication of
betasatellites. J Virol 93:1-22
Zaidi SSEA, RZ Naqvi, M Asif, S Strickler, S
Shakir, M Shafiq, AM Khan, I Amin, B Mishra, MS Mukhtar, BE Scheffler, JA
Scheffler, LA Mueller, S Mansoor (2020). Molecular insight into cotton leaf
curl geminivirus disease resistance in cultivated cotton (Gossypium hirsutum).
Plant Biotechnol J 18:691‒706
Zhang R, X Wu, X Jiang, X Wu, X Luan, X Cheng
(2020). Molecular characterization of common bean curly stunt virus: A novel
recombinant geminivirus in China. Arch
Virol 165:257‒260
Zhang SC, C Wege, H Jeske (2001a). Movement
proteins (BC1 and BV1) of Abutilon mosaic geminivirus are cotransported in and
between cells of sink but not of source leaves as detected by green fluorescent
protein tagging. Virology 290:249‒260
Zhang W, NH Olson, TS Baker, L Faulkner, M
Agbandje-McKenna, MI Boulton, JW Davies, R McKenna (2001b). Structure of the
maize streak virus geminate particle. Virology
279:471‒477